FASTA format description


A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. It is recommended that all lines of text should be shorter than 40 characters in length. An example sequence in FASTA
format is:
>gi|108096926|gb|DQ598979.1|piR-37045
TAACAAACGGTTTCATCAGTGGTGTG